README
¶
The GDC Client - Community Go Edition!
A community go implementation of the Genomic Data Commons Command Line Client and related libraries.
Installation
Pre-built versions of the GDC Client are available for most major operating systems and architectures. Simply download and extract the binary in order to use the client.
Building From Source
The GDC Client can be built from source using the Golang Go command.
go get github.com/gudCodes/gdc-client
This will download and build the gdc-client package along with all external
dependencies.
Usage
The Community GDC Client provides a collection of commands grouped by function.
A list of commands available and how to use them is available by running the
client without any arguments, or by specifying the -h or --help flags.
$ gdc-client
NAME:
gdc-client - The Genomics Data Commons Command Line Client
USAGE:
gdc-client [command] ...
VERSION:
2017.0.1
COMMANDS:
help, h Shows a list of commands or help for one command
data transfer:
upload upload data by GDC UUID
download download data to stdout
download-bulk download data in bulk to filesystem
metadata query:
query query metadata using GDC DSL
GLOBAL OPTIONS:
--help, -h show help
--version, -v print the version
The version of the client can be retrieved by supplying the -v or --version
flags without any command specified.
$ gdc-client --version
gdc-client version 2017.0.1
Help for specific commands can be found by specifying the same -h or --help
flags after the command's name.
$ gdc-client download -h
NAME:
gdc-client download - download data to stdout
USAGE:
gdc-client download [command options] ID
CATEGORY:
data transfer
OPTIONS:
--verbose verbose logging
--debug debug logging
-T value, --token value token string
-t value, --token-file value token file
-H value, --host value GDC API host (default: "gdc-api.nci.nih.gov") [$GDC_API_HOST]
-P value, --port value GDC API port (default: 443) [$GDC_API_PORT]
Encryption
The GDC Client is shipped with SSL / TLS encryption built-in and enabled. All pre-built versions of the GDC Client enforce verification of GDC API certificates and use of SSL / TLS encrypted connections.
Note that proper SSL / TLS encryption and certificate verification can be disabled when modifying and building the client from source. Doing so may violate government regulations regarding the proper handling of protected data. Please contact GDC support if you are unsure whether a modification to the client is compliant with government regulations applicable to use of the GDC.
Authentication & Authorization
The GDC API uses a token-based authentication mechanism for identifying users. Access to protected data via the GDC API will require a GDC auth token. This token identifies you as an individual and allows the GDC to track all actions taken by the holder of this token. A GDC auth token can be acquired by visiting the GDC Portal, logging in, and downloading a token file from your account drop-down menu.
Please secure your token and do not share with any other individual.
A GDC token is meant to be tied to a single individual. Sharing your token increases the likelihood of it being compromised and used by an unauthorized party. In the event that a token is believed to have been compromised, please contact GDC Support for assistance in revoking the token and getting a report of data access for your review.
Global Flags
The GDC Client operates as a thin HTTP(S) wrapper with some additional logic layered on top. All commands interact with the GDC API in some fashion, so certain flags are available for all commands. These include:
Enables verbose logging. This can include useful information when used in an interactive fashion.
Enables debug logging. This implies --verbose and includes information used
for identifying and diagnosing bugs in the client. Note that this can have a
negative impact on performance and may print sensitive information in plain
text. Caution should be taken when used in production environments.
In some cases it may be necessary to direct the client towards a different host than the public GDC API. This may include certain types of HTTP(S) proxies, such as UDT-enabled Parcel proxies for long-distance, high latency networks.
As with the -H / --host flags, alternative ports other than the standard
443 used for SSL-encrypted HTTP may be necessary.
A token file containing a GDC authentication token to be used with requests. Protected data stored by the GDC will need an authentication token in order to be accessed by clients. Authentication tokens can be downloaded from the GDC portal after logging in.
Environment Variables
The GDC Client is aware of certain environment variables.
The GDC_API_HOST environment variable performs the same action as
-H / --host. In the event that both GDC_API_HOST and -H / --host
are specified, the -H / --host will be used.
The GDC_API_PORT environment variable performs the same action as
-P / --port. In the event that both GDC_API_PORT and -P / --port
are specified, the -P / --port will be used.
The HTTP_PROXY and HTTPS_PROXY environment variables are both respected
by the GDC Client. Note that HTTPS_PROXY takes precedence over HTTP_PROXY
in all cases.
The NO_PROXY environment variable is respected by the GDC Client. This can
be used to avoid proxying connections to gdc-api.nci.nih.gov by adding the
GDC API hostname to the NO_PROXY environment variable:
$ export NO_PROXY=gdc-api.nci.nih.gov,${NO_PROXY}
This can be useful in environments that require low-volume traffic to be proxied for security purposes, but allow certain high-volume traffic to known, trusted hosts to bypass the proxy.
Download
The download command is the most fundamental of the client functionality.
By providing the client with a GDC UUID, the client will make a secure request
to the GDC API and stream the data for the specified GDC UUID to standard out.
$ gdc-client download -h
NAME:
gdc-client download - download data by GDC UUID
USAGE:
gdc-client download [command options] id [path]
CATEGORY:
data transfer
OPTIONS:
--verbose verbose logging
--debug debug logging
-T, --token token string
-t, --token-file token file
-H, --host "gdc-api.nci.nih.gov" GDC API host [$GDC_API_HOST]
-P, --port "443" GDC API port [$GDC_API_PORT]
NOTE that this command can produce significant output, especially when
working with large objects. This is an intended feature of the client that
facilitates the use of the client in downstream workflows. As an example,
the header from any BAM file in the GDC could be retrieved by piping the
output of download to samtools:
$ gdc-client download -t SUPER_SECRET_TOKEN_FILE e045df57-b8c4-4687-97bb-63b9f7a0357b | samtools view -H
@HD VN:1.5 SO:coordinate
@SQ SN:chr1 LN:248956422
@SQ SN:chr2 LN:242193529
@SQ SN:chr3 LN:198295559
@SQ SN:chr4 LN:190214555
@SQ SN:chr5 LN:181538259
@SQ SN:chr6 LN:170805979
@SQ SN:chr7 LN:159345973
@SQ SN:chr8 LN:145138636
@SQ SN:chr9 LN:138394717
...
Download (Bulk)
The download-bulk command is a convenience function for the download of
multiple files simultaneously from the GDC. By providing one or more GDC
UUIDs, the client will make secure requests to the GDC API and stream the
data for the specified GDC UUIDs to the local filesystem. Directories and
files will be created based upon the GDC UUIDs and filenames reported by
the GDC. An optional target path may be supplied to specify the desired
root directory to be used for download.
$ gdc-client download-bulk -h
NAME:
gdc-client download-bulk - download data in bulk to filesystem
USAGE:
gdc-client download-bulk [command options] [ID]+
CATEGORY:
data transfer
OPTIONS:
--verbose verbose logging
--debug debug logging
-T, --token token string
-t, --token-file token file
-H, --host "gdc-api.nci.nih.gov" GDC API host [$GDC_API_HOST]
-P, --port "443" GDC API port [$GDC_API_PORT]
-p, --path "." path to target directory
-m, --manifest GDC manifest file
NOTE this command assumes a POSIX-like file system on UNIX-like operating systems, including OS X. On windows operating systems, the current or target folder must support folder creation and file write operations for the current user.
$ gdc-client download-bulk --verbose -t SUPER_SECRET_TOKEN_FILE e045df57-b8c4-4687-97bb-63b9f7a0357b
INFO[0000] Downloading bulk...
INFO[0000] e045df57-b8c4-4687-97bb-63b9f7a0357b
e045df57-b8c4-4687-97bb-63b9f7a0357b 22.69 MB / 22.69 MB [=============================] 100.00% 20s
$ ls -F
e045df57-b8c4-4687-97bb-63b9f7a0357b/
$ ls -F e045df57-b8c4-4687-97bb-63b9f7a0357b
113075.bam
$ samtools view -H e045df57-b8c4-4687-97bb-63b9f7a0357b/113075.bam
@HD VN:1.5 SO:coordinate
@SQ SN:chr1 LN:248956422
@SQ SN:chr2 LN:242193529
@SQ SN:chr3 LN:198295559
@SQ SN:chr4 LN:190214555
@SQ SN:chr5 LN:181538259
@SQ SN:chr6 LN:170805979
@SQ SN:chr7 LN:159345973
@SQ SN:chr8 LN:145138636
@SQ SN:chr9 LN:138394717
...
$ samtools index e045df57-b8c4-4687-97bb-63b9f7a0357b/113075.bam
$ samtools view e045df57-b8c4-4687-97bb-63b9f7a0357b/113075.bam chr1:412892-412892
SOLEXA7_0100:5:100:5593:4686 16 chr1 412888 0 20M * 0 0 ACTGACTGACTGACTGACTG 9.(9B7/*?B'@-=+03(>,
Documentation
¶
There is no documentation for this package.